|
|
extractalign |
Please help by correcting and extending the Wiki pages.
Extract the region from position 10 to 20:
% extractalign dna.msf result.seq -regions '11-30' Extract regions from a sequence alignment |
Go to the input files for this example
Go to the output files for this example
Extract regions from a sequence alignment
Version: EMBOSS:6.2.0
Standard (Mandatory) qualifiers:
[-sequence] seqset (Aligned) sequence set filename and optional
format, or reference (input USA)
-regions range [Whole sequence] Regions to extract.
A set of regions is specified by a set of
pairs of positions.
The positions are integers.
They are separated by any non-digit,
non-alpha character.
Examples of region specifications are:
24-45, 56-78
1:45, 67=99;765..888
1,5,8,10,23,45,57,99
[-outseq] seqoutall [
|
| Qualifier | Type | Description | Allowed values | Default |
|---|---|---|---|---|
| Standard (Mandatory) qualifiers | ||||
| [-sequence] (Parameter 1) |
seqset | (Aligned) sequence set filename and optional format, or reference (input USA) | Readable set of sequences | Required |
| -regions | range | Regions to extract. A set of regions is specified by a set of pairs of positions. The positions are integers. They are separated by any non-digit, non-alpha character. Examples of region specifications are: 24-45, 56-78 1:45, 67=99;765..888 1,5,8,10,23,45,57,99 | Sequence range | Whole sequence |
| [-outseq] (Parameter 2) |
seqoutall | Sequence set(s) filename and optional format (output USA) | Writeable sequence(s) | <*>.format |
| Additional (Optional) qualifiers | ||||
| (none) | ||||
| Advanced (Unprompted) qualifiers | ||||
| (none) | ||||
| Associated qualifiers | ||||
| "-sequence" associated seqset qualifiers | ||||
| -sbegin1 -sbegin_sequence |
integer | Start of each sequence to be used | Any integer value | 0 |
| -send1 -send_sequence |
integer | End of each sequence to be used | Any integer value | 0 |
| -sreverse1 -sreverse_sequence |
boolean | Reverse (if DNA) | Boolean value Yes/No | N |
| -sask1 -sask_sequence |
boolean | Ask for begin/end/reverse | Boolean value Yes/No | N |
| -snucleotide1 -snucleotide_sequence |
boolean | Sequence is nucleotide | Boolean value Yes/No | N |
| -sprotein1 -sprotein_sequence |
boolean | Sequence is protein | Boolean value Yes/No | N |
| -slower1 -slower_sequence |
boolean | Make lower case | Boolean value Yes/No | N |
| -supper1 -supper_sequence |
boolean | Make upper case | Boolean value Yes/No | N |
| -sformat1 -sformat_sequence |
string | Input sequence format | Any string | |
| -sdbname1 -sdbname_sequence |
string | Database name | Any string | |
| -sid1 -sid_sequence |
string | Entryname | Any string | |
| -ufo1 -ufo_sequence |
string | UFO features | Any string | |
| -fformat1 -fformat_sequence |
string | Features format | Any string | |
| -fopenfile1 -fopenfile_sequence |
string | Features file name | Any string | |
| "-outseq" associated seqoutall qualifiers | ||||
| -osformat2 -osformat_outseq |
string | Output seq format | Any string | |
| -osextension2 -osextension_outseq |
string | File name extension | Any string | |
| -osname2 -osname_outseq |
string | Base file name | Any string | |
| -osdirectory2 -osdirectory_outseq |
string | Output directory | Any string | |
| -osdbname2 -osdbname_outseq |
string | Database name to add | Any string | |
| -ossingle2 -ossingle_outseq |
boolean | Separate file for each entry | Boolean value Yes/No | N |
| -oufo2 -oufo_outseq |
string | UFO features | Any string | |
| -offormat2 -offormat_outseq |
string | Features format | Any string | |
| -ofname2 -ofname_outseq |
string | Features file name | Any string | |
| -ofdirectory2 -ofdirectory_outseq |
string | Output directory | Any string | |
| General qualifiers | ||||
| -auto | boolean | Turn off prompts | Boolean value Yes/No | N |
| -stdout | boolean | Write first file to standard output | Boolean value Yes/No | N |
| -filter | boolean | Read first file from standard input, write first file to standard output | Boolean value Yes/No | N |
| -options | boolean | Prompt for standard and additional values | Boolean value Yes/No | N |
| -debug | boolean | Write debug output to program.dbg | Boolean value Yes/No | N |
| -verbose | boolean | Report some/full command line options | Boolean value Yes/No | Y |
| -help | boolean | Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose | Boolean value Yes/No | N |
| -warning | boolean | Report warnings | Boolean value Yes/No | Y |
| -error | boolean | Report errors | Boolean value Yes/No | Y |
| -fatal | boolean | Report fatal errors | Boolean value Yes/No | Y |
| -die | boolean | Report dying program messages | Boolean value Yes/No | Y |
| -version | boolean | Report version number and exit | Boolean value Yes/No | N |
!!NA_MULTIPLE_ALIGNMENT
dna.msf MSF: 120 Type: N January 01, 1776 12:00 Check: 3196 ..
Name: MSFM1 Len: 120 Check: 8587 Weight: 1.00
Name: MSFM2 Len: 120 Check: 6178 Weight: 1.00
Name: MSFM3 Len: 120 Check: 8431 Weight: 1.00
//
MSFM1 ACGTACGTAC GTACGTACGT ACGTACGTAC GTACGTACGT ACGTACGTAC
MSFM2 ACGTACGTAC GTACGTACGT ....ACGTAC GTACGTACGT ACGTACGTAC
MSFM3 ACGTACGTAC GTACGTACGT ACGTACGTAC GTACGTACGT CGTACGTACG
MSFM1 GTACGTACGT ACGTACGTAC GTACGTACGT ACGTACGTAC GTACGTACGT
MSFM2 GTACGTACGT ACGTACGTAC GTACGTACGT ACGTACGTAC GTACGTACGT
MSFM3 TACGTACGTA CGTACGTACG TACGTACGTA ACGTACGTAC GTACGTACGT
MSFM1 ACGTACGTAC GTACGTACGT
MSFM2 ACGTACGTTG CAACGTACGT
MSFM3 ACGTACGTAC GTACGTACGT
|
You can specifiy a file of ranges to extract by giving the '-regions' qualifier the value '@' followed by the name of the file containing the ranges. (eg: '-regions @myfile').
The format of the range file is:
An example range file is:
# this is my set of ranges 12 23 4 5 this is like 12-23, but smaller 67 10348 interesting region
>MSFM1 GTACGTACGTACGTACGTAC >MSFM2 GTACGTACGT----ACGTAC >MSFM3 GTACGTACGTACGTACGTAC |
If the option '-separate' is used then each specified region is written to the output file as a separate sequence. The name of the sequence is created from the name of the original sequence with the start and end positions of the range appended with underscore characters between them,
For example: "XYZ region 2 to 34" is written as: "XYZ_2_34"
| Program name | Description |
|---|---|
| aligncopy | Reads and writes alignments |
| aligncopypair | Reads and writes pairs from alignments |
| biosed | Replace or delete sequence sections |
| codcopy | Copy and reformat a codon usage table |
| cutseq | Removes a section from a sequence |
| degapseq | Removes non-alphabetic (e.g. gap) characters from sequences |
| descseq | Alter the name or description of a sequence |
| entret | Retrieves sequence entries from flatfile databases and files |
| extractfeat | Extract features from sequence(s) |
| extractseq | Extract regions from a sequence |
| featcopy | Reads and writes a feature table |
| featreport | Reads and writes a feature table |
| listor | Write a list file of the logical OR of two sets of sequences |
| makenucseq | Create random nucleotide sequences |
| makeprotseq | Create random protein sequences |
| maskambignuc | Masks all ambiguity characters in nucleotide sequences with N |
| maskambigprot | Masks all ambiguity characters in protein sequences with X |
| maskfeat | Write a sequence with masked features |
| maskseq | Write a sequence with masked regions |
| newseq | Create a sequence file from a typed-in sequence |
| nohtml | Remove mark-up (e.g. HTML tags) from an ASCII text file |
| noreturn | Remove carriage return from ASCII files |
| nospace | Remove all whitespace from an ASCII text file |
| notab | Replace tabs with spaces in an ASCII text file |
| notseq | Write to file a subset of an input stream of sequences |
| nthseq | Write to file a single sequence from an input stream of sequences |
| nthseqset | Reads and writes (returns) one set of sequences from many |
| pasteseq | Insert one sequence into another |
| revseq | Reverse and complement a nucleotide sequence |
| seqret | Reads and writes (returns) sequences |
| seqretsetall | Reads and writes (returns) many sets of sequences |
| seqretsplit | Reads sequences and writes them to individual files |
| sizeseq | Sort sequences by size |
| skipredundant | Remove redundant sequences from an input set |
| skipseq | Reads and writes (returns) sequences, skipping first few |
| splitsource | Split sequence(s) into original source sequences |
| splitter | Split sequence(s) into smaller sequences |
| trimest | Remove poly-A tails from nucleotide sequences |
| trimseq | Remove unwanted characters from start and end of sequence(s) |
| trimspace | Remove extra whitespace from an ASCII text file |
| union | Concatenate multiple sequences into a single sequence |
| vectorstrip | Removes vectors from the ends of nucleotide sequence(s) |
| yank | Add a sequence reference (a full USA) to a list file |