|
|
einverted |
Please help by correcting and extending the Wiki pages.
einverted finds inverted repeats (stem loops) in nucleotide sequences. It identifies regions of local alignment of the input sequence and its reverse complement that exceed a threshold score. The alignments may include a proportion of mismatches and gaps, which correspond to bulges in the stem loop. One or more sequences are read and a file with the sequence(s) (without gap characters) of the inverted repeat regions is written. It can find multiple inverted repeats in a sequence. Only non-overlapping matches are reported.
einverted uses dynamic programming and thus is guaranteed to find optimal, local alignments between the sequence and its reverse complement. Matched bases contribute positively to the score whereas gaps and mismatches are penalised. The score for a local alignment is the sum of the values of each match, minus penalties for mismatches and gap insertion. Any region whose score exceeds the threshold is reported. The gap penalty, match score and mismatch score, and the threshold score for reporting regions, are all user-specified.
% einverted tembl:d00596 Finds inverted repeats in nucleotide sequences Gap penalty [12]: Minimum score threshold [50]: Match score [3]: Mismatch score [-4]: Sanger Centre program inverted output file [d00596.inv]: File for sequence of regions of inverted repeats. [d00596.fasta]: |
Go to the input files for this example
Go to the output files for this example
Finds inverted repeats in nucleotide sequences
Version: EMBOSS:6.2.0
Standard (Mandatory) qualifiers:
[-sequence] seqall Nucleotide sequence(s) filename and optional
format, or reference (input USA)
-gap integer [12] Gap penalty (Any integer value)
-threshold integer [50] Minimum score threshold (Any integer
value)
-match integer [3] Match score (Any integer value)
-mismatch integer [-4] Mismatch score (Any integer value)
[-outfile] outfile [*.einverted] Sanger Centre program inverted
output file
[-outseq] seqout [
|
| Qualifier | Type | Description | Allowed values | Default |
|---|---|---|---|---|
| Standard (Mandatory) qualifiers | ||||
| [-sequence] (Parameter 1) |
seqall | Nucleotide sequence(s) filename and optional format, or reference (input USA) | Readable sequence(s) | Required |
| -gap | integer | Gap penalty | Any integer value | 12 |
| -threshold | integer | Minimum score threshold | Any integer value | 50 |
| -match | integer | Match score | Any integer value | 3 |
| -mismatch | integer | Mismatch score | Any integer value | -4 |
| [-outfile] (Parameter 2) |
outfile | Sanger Centre program inverted output file | Output file | <*>.einverted |
| [-outseq] (Parameter 3) |
seqout | The sequence of the inverted repeat regions without gap characters. | Writeable sequence | <*>.format |
| Additional (Optional) qualifiers | ||||
| -maxrepeat | integer | Maximum separation between the start of repeat and the end of the inverted repeat (the default is 2000 bases). | Any integer value | 2000 |
| Advanced (Unprompted) qualifiers | ||||
| (none) | ||||
| Associated qualifiers | ||||
| "-sequence" associated seqall qualifiers | ||||
| -sbegin1 -sbegin_sequence |
integer | Start of each sequence to be used | Any integer value | 0 |
| -send1 -send_sequence |
integer | End of each sequence to be used | Any integer value | 0 |
| -sreverse1 -sreverse_sequence |
boolean | Reverse (if DNA) | Boolean value Yes/No | N |
| -sask1 -sask_sequence |
boolean | Ask for begin/end/reverse | Boolean value Yes/No | N |
| -snucleotide1 -snucleotide_sequence |
boolean | Sequence is nucleotide | Boolean value Yes/No | N |
| -sprotein1 -sprotein_sequence |
boolean | Sequence is protein | Boolean value Yes/No | N |
| -slower1 -slower_sequence |
boolean | Make lower case | Boolean value Yes/No | N |
| -supper1 -supper_sequence |
boolean | Make upper case | Boolean value Yes/No | N |
| -sformat1 -sformat_sequence |
string | Input sequence format | Any string | |
| -sdbname1 -sdbname_sequence |
string | Database name | Any string | |
| -sid1 -sid_sequence |
string | Entryname | Any string | |
| -ufo1 -ufo_sequence |
string | UFO features | Any string | |
| -fformat1 -fformat_sequence |
string | Features format | Any string | |
| -fopenfile1 -fopenfile_sequence |
string | Features file name | Any string | |
| "-outfile" associated outfile qualifiers | ||||
| -odirectory2 -odirectory_outfile |
string | Output directory | Any string | |
| "-outseq" associated seqout qualifiers | ||||
| -osformat3 -osformat_outseq |
string | Output seq format | Any string | |
| -osextension3 -osextension_outseq |
string | File name extension | Any string | |
| -osname3 -osname_outseq |
string | Base file name | Any string | |
| -osdirectory3 -osdirectory_outseq |
string | Output directory | Any string | |
| -osdbname3 -osdbname_outseq |
string | Database name to add | Any string | |
| -ossingle3 -ossingle_outseq |
boolean | Separate file for each entry | Boolean value Yes/No | N |
| -oufo3 -oufo_outseq |
string | UFO features | Any string | |
| -offormat3 -offormat_outseq |
string | Features format | Any string | |
| -ofname3 -ofname_outseq |
string | Features file name | Any string | |
| -ofdirectory3 -ofdirectory_outseq |
string | Output directory | Any string | |
| General qualifiers | ||||
| -auto | boolean | Turn off prompts | Boolean value Yes/No | N |
| -stdout | boolean | Write first file to standard output | Boolean value Yes/No | N |
| -filter | boolean | Read first file from standard input, write first file to standard output | Boolean value Yes/No | N |
| -options | boolean | Prompt for standard and additional values | Boolean value Yes/No | N |
| -debug | boolean | Write debug output to program.dbg | Boolean value Yes/No | N |
| -verbose | boolean | Report some/full command line options | Boolean value Yes/No | Y |
| -help | boolean | Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose | Boolean value Yes/No | N |
| -warning | boolean | Report warnings | Boolean value Yes/No | Y |
| -error | boolean | Report errors | Boolean value Yes/No | Y |
| -fatal | boolean | Report fatal errors | Boolean value Yes/No | Y |
| -die | boolean | Report dying program messages | Boolean value Yes/No | Y |
| -version | boolean | Report version number and exit | Boolean value Yes/No | N |
ID D00596; SV 1; linear; genomic DNA; STD; HUM; 18596 BP.
XX
AC D00596;
XX
DT 17-JUL-1991 (Rel. 28, Created)
DT 07-DEC-2007 (Rel. 94, Last updated, Version 6)
XX
DE Homo sapiens gene for thymidylate synthase, complete cds.
XX
KW .
XX
OS Homo sapiens (human)
OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC Homo.
XX
RN [1]
RP 1-18596
RX PUBMED; 2243092.
RA Kaneda S., Nalbantoglu J., Takeishi K., Shimizu K., Gotoh O., Seno T.,
RA Ayusawa D.;
RT "Structural and functional analysis of the human thymidylate synthase
RT gene";
RL J. Biol. Chem. 265(33):20277-20284(1990).
XX
DR GDB; 163670.
DR GDB; 182340.
XX
CC These data kindly submitted in computer readable form by:
CC Sumiko Kaneda
CC National Institute of Genetics
CC 1111 Yata
CC Mishima 411
CC Japan
XX
FH Key Location/Qualifiers
FH
FT source 1..18596
FT /organism="Homo sapiens"
FT /chromosome="18"
FT /map="18p11.32"
FT /mol_type="genomic DNA"
FT /clone="lambdaHTS-1 and lambdaHTS-3"
FT /db_xref="taxon:9606"
FT repeat_region 1..148
FT /rpt_family="Alu"
FT repeat_region 202..477
FT /rpt_family="Alu"
FT prim_transcript 822..16246
FT /note="thymidylate synthase mRNA and introns"
[Part of this file has been deleted for brevity]
ttttgttttt agcttcagcg agaacccaga cctttcccaa agctcaggat tcttcgaaaa 15660
gttgagaaaa ttgatgactt caaagctgaa gactttcaga ttgaagggta caatccgcat 15720
ccaactatta aaatggaaat ggctgtttag ggtgctttca aaggagctcg aaggatattg 15780
tcagtcttta ggggttgggc tggatgccga ggtaaaagtt ctttttgctc taaaagaaaa 15840
aggaactagg tcaaaaatct gtccgtgacc tatcagttat taatttttaa ggatgttgcc 15900
actggcaaat gtaactgtgc cagttctttc cataataaaa ggctttgagt taactcactg 15960
agggtatctg acaatgctga ggttatgaac aaagtgagga gaatgaaatg tatgtgctct 16020
tagcaaaaac atgtatgtgc atttcaatcc cacgtactta taaagaaggt tggtgaattt 16080
cacaagctat ttttggaata tttttagaat attttaagaa tttcacaagc tattccctca 16140
aatctgaggg agctgagtaa caccatcgat catgatgtag agtgtggtta tgaactttaa 16200
agttatagtt gttttatatg ttgctataat aaagaagtgt tctgcattcg tccacgcttt 16260
gttcattctg tactgccact tatctgctca gttccttcct aaaatagatt aaagaactct 16320
ccttaagtaa acatgtgctg tattctggtt tggatgctac ttaaaagagt atattttaga 16380
aataatagtg aatatatttt gccctatttt tctcatttta actgcatctt atcctcaaaa 16440
tataatgacc atttaggata gagttttttt tttttttttt taaactttta taaccttaaa 16500
gggttatttt aaaataatct atggactacc attttgccct cattagcttc agcatggtgt 16560
gacttctcta ataatatgct tagattaagc aaggaaaaga tgcaaaacca cttcggggtt 16620
aatcagtgaa atatttttcc cttcgttgca taccagatac ccccggtgtt gcacgactat 16680
ttttattctg ctaatttatg acaagtgtta aacagaacaa ggaattattc caacaagtta 16740
tgcaacatgt tgcttatttt caaattacag tttaatgtct aggtgccagc ccttgatata 16800
gctatttttg taagaacatc ctcctggact ttgggttagt taaatctaaa cttatttaag 16860
gattaagtag gataacgtgc attgatttgc taaaagaatc aagtaataat tacttagctg 16920
attcctgagg gtggtatgac ttctagctga actcatcttg atcggtagga ttttttaaat 16980
ccatttttgt aaaactattt ccaagaaatt ttaagccctt tcacttcaga aagaaaaaag 17040
ttgttggggc tgagcactta attttcttga gcaggaagga gtttcttcca aacttcacca 17100
tctggagact ggtgtttctt tacagattcc tccttcattt ctgttgagta gccgggatcc 17160
tatcaaagac caaaaaaatg agtcctgtta acaaccacct ggaacaaaaa cagattttat 17220
gcatttatgc tgctccaaga aatgctttta cgtctaagcc agaggcaatt aattaatttt 17280
tttttttttg acatggagtc actgtccgtt gcccaggctg cagtgcagtg gcgcaatctt 17340
ggctcactgc aacctccacc tcccaggttc aagtgattct cctgcctcag cctcccatgt 17400
agctgggatc acaggcacct gccaccatgc ccggctaatt ttttgtattt tttgtagaga 17460
cagggtttca ccatgttggc caggctggtc tcaaacacct gacctcaaat gatccacctg 17520
cctcagcctc ccaaagtgtt gggattacag gcgtaagcca ccatgcccag ccctgaatta 17580
atatttttaa aataagtttg gagactgttg gaaataatag ggcagaggaa catattttac 17640
tggctacttg ccagagttag ttaactcatc aaactctttg ataatagttt gacctctgtt 17700
ggtgaaaatg agccatgatc tcttgaacat gatcagaata aatgccccag ccacacaatt 17760
gtagtccaaa ctttttaggt cactaacttg ctagatggtg ccaggttttt ttgcacaagg 17820
agtgcaaatg ttaagatctc cactagtgag gaaaggctag tattacagaa gccttgtcag 17880
aggcaattga acctccaagc cctggccctc aggcctgagg attttgatac agacaaactg 17940
aagaaccgtt tgttagtgga tattgcaaac aaacaggagt caaagcttgg tgctccacag 18000
tctagttcac gagacaggcg tggcagtggc tggcagcatc tcttctcaca ggggccctca 18060
ggcacagctt accttgggag gcatgtagga agcccgctgg atcatcacgg gatacttgaa 18120
atgctcatgc aggtggtcaa catactcaca caccctagga ggagggaatc agatcggggc 18180
aatgatgcct gaagtcagat tattcacgtg gtgctaactt aaagcagaag gagcgagtac 18240
cactcaattg acagtgttgg ccaaggctta gctgtgttac catgcgtttc taggcaagtc 18300
cctaaacctc tgtgcctcag gtccttttct tctaaaatat agcaatgtga ggtggggact 18360
ttgatgacat gaacacacga agtccctctg agaggttttg tggtgccctt taaaagggat 18420
caattcagac tctgtaaata tccagaatta tttgggttcc tctggtcaaa agtcagatga 18480
atagattaaa atcaccacat tttgtgatct atttttcaag aagcgtttgt attttttcat 18540
atggctgcag cagctgccag gggcttgggg tttttttggc aggtagggtt gggagg 18596
//
|
>D00596_13_142 gctacgcgagaggctgaggcagcagaattacttgaacccaggaggcggaggttgcagtga gccgagatcgcgccactgcactccagcctgggtgagagagcgagactctgtctcaaaaaa aaaaaaaaaa >D00596_199_328 ttttttttttttttttttgggacagtcttgctctgtcgcccaggctggagtacaatggtc ggatcttggctcactgcaacctctgcctcccaggttcaagcaattcttctgcctcagcct cccaagtagc >D00596_12128_12301 agaggatttttttttttttttttttttttgagacagagttttgctctgttgcccaggctg gaatgcaacggcgtgatcttggctcactgtaacctctgcctcctgggttcgagtgattct cctgcctcagcctccaagtagctgggattacagcatgtgccaccatgcctggct >D00596_12573_12749 agccaggtgtggtggctcacacctgtaattccaacaactccagaggccaaggcgagagga tcatttgaacccacggaatttgaggctgtagtgagtcatgatcacgccattgcactccat cctgggcaacagagtgagaccctgaatatttaaaaacaacaacaacaacaaaactct >D00596_12246_12296 ctcctgcctcagcctccaagtagctgggattacagcatgtgccaccatgcc >D00596_13886_13938 ggtatggtggctcatgcctgtaatcccagcactttggaagactgagacaggag >D00596_13884_13949 tgggtatggtggctcatgcctgtaatcccagcactttggaagactgagacaggagcaatt gcttga >D00596_14628_14692 tcaagcaattcttctgcctcagcctcccaggtagctgggattacaggcacatgccaccac accca |
D00596: Score 236: 108/130 ( 83%) matches, 0 gaps
13 gctacgcgagaggctgaggcagcagaattacttgaacccaggaggcggaggttgcagtgagccgagatcgcgccactgcactccagcctgggtgagagagcgagactctgtctcaaaaaaaaaaaaaaaa 142
||||| | ||||||||||||| |||||| |||||||| |||||| |||||||||||||||| ||||| ||| || ||||||||||||| || ||||| ||||| | | ||||||||||||||||
328 cgatgaaccctccgactccgtcttcttaacgaacttggaccctccgtctccaacgtcactcggttctaggctggtaacatgaggtcggacccgctgtctcgttctgacagggtttttttttttttttttt 199
D00596: Score 164: 128/174 ( 73%) matches, 3 gaps
12128 agaggatttttttttttttttttttttttgagacagagttttgctctgttgcccaggctggaatgcaacggcgtgatcttggctcactgtaacctctgcctcc-tgggttcgagtgattctcctgcctcagcctc-caagtagctgggattaca-gcatgtgccaccatgcctggct 12301
|||| || || || || || ||||| | ||| || | |||||||||||||| |||| ||||| ||||||||| || |||||| | |||| ||| ||||||| | |||| ||| |||| ||||| ||| | ||| |||||| | || ||||||| |||||||
12749 tctcaaaacaacaacaacaacaaaaatttataagtcccagagtgagacaacgggtcctacctcacgttaccgcactagtactgagtgatgtcggagtttaaggcacccaagtttactaggagagcggaaccggagacctcaacaaccttaatgtccacactcggtggtgtggaccga 12573
D00596: Score 80: 44/51 ( 86%) matches, 2 gaps
12246 ctcctgcctcag-cctccaagtagctgggattaca-gcatgtgccaccatgcc 12296
|||||| ||||| | ||||| |||||||||||| ||||| |||||||| ||
13938 gaggacagagtcagaaggtttcacgaccctaatgtccgtactcggtggtatgg 13886
D00596: Score 99: 53/65 ( 81%) matches, 1 gaps
13884 tgggtatggtggctcatgcctgtaatcccagcactttggaagactgagacaggagcaattgcttga 13949
||||| ||||||| |||||||||||||||| ||| || ||||| ||| || ||||||||||
14692 acccacaccaccgtacacggacattagggtcgatggaccctccgactccgtcttc-ttaacgaact 14628
|
The original "inverted" program (from which einverted was derived) was used to annotate the nematode genome. Excluding overlapping repeats saved problems with simple repeat sequences in this genome.
einverted will find optimal alignments but is slower than heuristic methods such as BLAST.
Sometimes you can find repeats using the program palindrome that you can't find with einverted using the default parameters.This is not due to a problem with either program. It is simply because some of the shortest repeats that you find with palindrome's default parameter values are below einverted's default cutoff score - you should decrease the 'Minimum score threshold' to see them.
For example, when palindrome is run with 'em:x65921', it finds the repeat:
64 aaaactaaggc 74
|||||||||||
98 ttttgattccg 88
einverted will not report this as its score is 33 (11 bases scoring 3 each, no mismatches or gaps) which is below the default score cutoff of 50.
If einverted is run as:
% einverted em:x65921 -threshold 30
then it will find it:
Score 33: 11/11 (100%) matches, 0 gaps
64 aaaactaaggc 74
|||||||||||
98 ttttgattccg 88
Anything can be considered to be a repeat if you set the score threshold low enough!
einverted does not report overlapping matches.
| Program name | Description |
|---|---|
| equicktandem | Finds tandem repeats in nucleotide sequences |
| etandem | Finds tandem repeats in a nucleotide sequence |
| palindrome | Finds inverted repeats in nucleotide sequence(s) |
This application was modified for inclusion in EMBOSS by
Peter Rice (pmr © ebi.ac.uk)
European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK