|
|
cutseq |
Please help by correcting and extending the Wiki pages.
This simple editing program allows you to cut out a region from your sequence by specifying the begin and end positions of the region to remove. It removes the sequence from the specified start to the end positions (inclusive) and writes the remaining sequence to the output file.
To remove bases 10 to 12 from a database entry and write to the new sequence file 'gatta2.seq':
% cutseq tembl:x13776 gatta2.seq -from=10 -to=12 Removes a section from a sequence |
Go to the input files for this example
Go to the output files for this example
Example 2
To remove the first 20 bases from 'tembl:x13776' and write it to 'jsh.seq':
% cutseq tembl:x13776 -from=1 -to=20 -out=jsh.seq Removes a section from a sequence |
Go to the output files for this example
Example 3
If the default start and end positions are accepted, then all of the sequence is removed!
% cutseq tembl:x13776 starta.seq -sbeg=-1000 -send=1290 Removes a section from a sequence Start of region to delete [1168]: End of region to delete [1290]: |
Go to the output files for this example
Removes a section from a sequence
Version: EMBOSS:6.2.0
Standard (Mandatory) qualifiers:
[-sequence] sequence (Gapped) sequence filename and optional
format, or reference (input USA)
-from integer [Start of sequence (0)] This is the start
position (inclusive) of the section of the
sequence that you wish to remove. (Any
integer value)
-to integer [End of sequence (0)] This is the end
position (inclusive) of the section of the
sequence that you wish to remove. (Any
integer value)
[-outseq] seqout [
|
| Qualifier | Type | Description | Allowed values | Default |
|---|---|---|---|---|
| Standard (Mandatory) qualifiers | ||||
| [-sequence] (Parameter 1) |
sequence | (Gapped) sequence filename and optional format, or reference (input USA) | Readable sequence | Required |
| -from | integer | This is the start position (inclusive) of the section of the sequence that you wish to remove. | Any integer value | Start of sequence (0) |
| -to | integer | This is the end position (inclusive) of the section of the sequence that you wish to remove. | Any integer value | End of sequence (0) |
| [-outseq] (Parameter 2) |
seqout | Sequence filename and optional format (output USA) | Writeable sequence | <*>.format |
| Additional (Optional) qualifiers | ||||
| (none) | ||||
| Advanced (Unprompted) qualifiers | ||||
| (none) | ||||
| Associated qualifiers | ||||
| "-sequence" associated sequence qualifiers | ||||
| -sbegin1 -sbegin_sequence |
integer | Start of the sequence to be used | Any integer value | 0 |
| -send1 -send_sequence |
integer | End of the sequence to be used | Any integer value | 0 |
| -sreverse1 -sreverse_sequence |
boolean | Reverse (if DNA) | Boolean value Yes/No | N |
| -sask1 -sask_sequence |
boolean | Ask for begin/end/reverse | Boolean value Yes/No | N |
| -snucleotide1 -snucleotide_sequence |
boolean | Sequence is nucleotide | Boolean value Yes/No | N |
| -sprotein1 -sprotein_sequence |
boolean | Sequence is protein | Boolean value Yes/No | N |
| -slower1 -slower_sequence |
boolean | Make lower case | Boolean value Yes/No | N |
| -supper1 -supper_sequence |
boolean | Make upper case | Boolean value Yes/No | N |
| -sformat1 -sformat_sequence |
string | Input sequence format | Any string | |
| -sdbname1 -sdbname_sequence |
string | Database name | Any string | |
| -sid1 -sid_sequence |
string | Entryname | Any string | |
| -ufo1 -ufo_sequence |
string | UFO features | Any string | |
| -fformat1 -fformat_sequence |
string | Features format | Any string | |
| -fopenfile1 -fopenfile_sequence |
string | Features file name | Any string | |
| "-outseq" associated seqout qualifiers | ||||
| -osformat2 -osformat_outseq |
string | Output seq format | Any string | |
| -osextension2 -osextension_outseq |
string | File name extension | Any string | |
| -osname2 -osname_outseq |
string | Base file name | Any string | |
| -osdirectory2 -osdirectory_outseq |
string | Output directory | Any string | |
| -osdbname2 -osdbname_outseq |
string | Database name to add | Any string | |
| -ossingle2 -ossingle_outseq |
boolean | Separate file for each entry | Boolean value Yes/No | N |
| -oufo2 -oufo_outseq |
string | UFO features | Any string | |
| -offormat2 -offormat_outseq |
string | Features format | Any string | |
| -ofname2 -ofname_outseq |
string | Features file name | Any string | |
| -ofdirectory2 -ofdirectory_outseq |
string | Output directory | Any string | |
| General qualifiers | ||||
| -auto | boolean | Turn off prompts | Boolean value Yes/No | N |
| -stdout | boolean | Write first file to standard output | Boolean value Yes/No | N |
| -filter | boolean | Read first file from standard input, write first file to standard output | Boolean value Yes/No | N |
| -options | boolean | Prompt for standard and additional values | Boolean value Yes/No | N |
| -debug | boolean | Write debug output to program.dbg | Boolean value Yes/No | N |
| -verbose | boolean | Report some/full command line options | Boolean value Yes/No | Y |
| -help | boolean | Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose | Boolean value Yes/No | N |
| -warning | boolean | Report warnings | Boolean value Yes/No | Y |
| -error | boolean | Report errors | Boolean value Yes/No | Y |
| -fatal | boolean | Report fatal errors | Boolean value Yes/No | Y |
| -die | boolean | Report dying program messages | Boolean value Yes/No | Y |
| -version | boolean | Report version number and exit | Boolean value Yes/No | N |
ID X13776; SV 1; linear; genomic DNA; STD; PRO; 2167 BP.
XX
AC X13776; M43175;
XX
DT 19-APR-1989 (Rel. 19, Created)
DT 14-NOV-2006 (Rel. 89, Last updated, Version 24)
XX
DE Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation
XX
KW aliphatic amidase regulator; amiC gene; amiR gene.
XX
OS Pseudomonas aeruginosa
OC Bacteria; Proteobacteria; Gammaproteobacteria; Pseudomonadales;
OC Pseudomonadaceae; Pseudomonas.
XX
RN [1]
RP 1167-2167
RA Rice P.M.;
RT ;
RL Submitted (16-DEC-1988) to the EMBL/GenBank/DDBJ databases.
RL Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG.
XX
RN [2]
RP 1167-2167
RX DOI; 10.1016/0014-5793(89)80249-2.
RX PUBMED; 2495988.
RA Lowe N., Rice P.M., Drew R.E.;
RT "Nucleotide sequence of the aliphatic amidase regulator gene (amiR) of
RT Pseudomonas aeruginosa";
RL FEBS Lett. 246(1-2):39-43(1989).
XX
RN [3]
RP 1-1292
RX PUBMED; 1907262.
RA Wilson S., Drew R.;
RT "Cloning and DNA sequence of amiC, a new gene regulating expression of the
RT Pseudomonas aeruginosa aliphatic amidase, and purification of the amiC
RT product";
RL J. Bacteriol. 173(16):4914-4921(1991).
XX
RN [4]
RP 1-2167
RA Rice P.M.;
RT ;
RL Submitted (04-SEP-1991) to the EMBL/GenBank/DDBJ databases.
RL Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG.
XX
DR GOA; Q51417.
DR InterPro; IPR003211; AmiSUreI_transpt.
DR UniProtKB/Swiss-Prot; Q51417; AMIS_PSEAE.
[Part of this file has been deleted for brevity]
FT /replace=""
FT /note="ClaI fragment deleted in pSW36, constitutive
FT phenotype"
FT misc_feature 1
FT /note="last base of an XhoI site"
FT misc_feature 648..653
FT /note="end of 658bp XhoI fragment, deletion in pSW3 causes
FT constitutive expression of amiE"
FT conflict 1281
FT /replace="g"
FT /citation=[3]
XX
SQ Sequence 2167 BP; 363 A; 712 C; 730 G; 362 T; 0 other;
ggtaccgctg gccgagcatc tgctcgatca ccaccagccg ggcgacggga actgcacgat 60
ctacctggcg agcctggagc acgagcgggt tcgcttcgta cggcgctgag cgacagtcac 120
aggagaggaa acggatggga tcgcaccagg agcggccgct gatcggcctg ctgttctccg 180
aaaccggcgt caccgccgat atcgagcgct cgcacgcgta tggcgcattg ctcgcggtcg 240
agcaactgaa ccgcgagggc ggcgtcggcg gtcgcccgat cgaaacgctg tcccaggacc 300
ccggcggcga cccggaccgc tatcggctgt gcgccgagga cttcattcgc aaccgggggg 360
tacggttcct cgtgggctgc tacatgtcgc acacgcgcaa ggcggtgatg ccggtggtcg 420
agcgcgccga cgcgctgctc tgctacccga ccccctacga gggcttcgag tattcgccga 480
acatcgtcta cggcggtccg gcgccgaacc agaacagtgc gccgctggcg gcgtacctga 540
ttcgccacta cggcgagcgg gtggtgttca tcggctcgga ctacatctat ccgcgggaaa 600
gcaaccatgt gatgcgccac ctgtatcgcc agcacggcgg cacggtgctc gaggaaatct 660
acattccgct gtatccctcc gacgacgact tgcagcgcgc cgtcgagcgc atctaccagg 720
cgcgcgccga cgtggtcttc tccaccgtgg tgggcaccgg caccgccgag ctgtatcgcg 780
ccatcgcccg tcgctacggc gacggcaggc ggccgccgat cgccagcctg accaccagcg 840
aggcggaggt ggcgaagatg gagagtgacg tggcagaggg gcaggtggtg gtcgcgcctt 900
acttctccag catcgatacg cccgccagcc gggccttcgt ccaggcctgc catggtttct 960
tcccggagaa cgcgaccatc accgcctggg ccgaggcggc ctactggcag accttgttgc 1020
tcggccgcgc cgcgcaggcc gcaggcaact ggcgggtgga agacgtgcag cggcacctgt 1080
acgacatcga catcgacgcg ccacaggggc cggtccgggt ggagcgccag aacaaccaca 1140
gccgcctgtc ttcgcgcatc gcggaaatcg atgcgcgcgg cgtgttccag gtccgctggc 1200
agtcgcccga accgattcgc cccgaccctt atgtcgtcgt gcataacctc gacgactggt 1260
ccgccagcat gggcggggga ccgctcccat gagcgccaac tcgctgctcg gcagcctgcg 1320
cgagttgcag gtgctggtcc tcaacccgcc gggggaggtc agcgacgccc tggtcttgca 1380
gctgatccgc atcggttgtt cggtgcgcca gtgctggccg ccgccggaag ccttcgacgt 1440
gccggtggac gtggtcttca ccagcatttt ccagaatggc caccacgacg agatcgctgc 1500
gctgctcgcc gccgggactc cgcgcactac cctggtggcg ctggtggagt acgaaagccc 1560
cgcggtgctc tcgcagatca tcgagctgga gtgccacggc gtgatcaccc agccgctcga 1620
tgcccaccgg gtgctgcctg tgctggtatc ggcgcggcgc atcagcgagg aaatggcgaa 1680
gctgaagcag aagaccgagc agctccagga ccgcatcgcc ggccaggccc ggatcaacca 1740
ggccaaggtg ttgctgatgc agcgccatgg ctgggacgag cgcgaggcgc accagcacct 1800
gtcgcgggaa gcgatgaagc ggcgcgagcc gatcctgaag atcgctcagg agttgctggg 1860
aaacgagccg tccgcctgag cgatccgggc cgaccagaac aataacaaga ggggtatcgt 1920
catcatgctg ggactggttc tgctgtacgt tggcgcggtg ctgtttctca atgccgtctg 1980
gttgctgggc aagatcagcg gtcgggaggt ggcggtgatc aacttcctgg tcggcgtgct 2040
gagcgcctgc gtcgcgttct acctgatctt ttccgcagca gccgggcagg gctcgctgaa 2100
ggccggagcg ctgaccctgc tattcgcttt tacctatctg tgggtggccg ccaaccagtt 2160
cctcgag 2167
//
|
>X13776 X13776.1 Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation ggtaccgctcgagcatctgctcgatcaccaccagccgggcgacgggaactgcacgatcta cctggcgagcctggagcacgagcgggttcgcttcgtacggcgctgagcgacagtcacagg agaggaaacggatgggatcgcaccaggagcggccgctgatcggcctgctgttctccgaaa ccggcgtcaccgccgatatcgagcgctcgcacgcgtatggcgcattgctcgcggtcgagc aactgaaccgcgagggcggcgtcggcggtcgcccgatcgaaacgctgtcccaggaccccg gcggcgacccggaccgctatcggctgtgcgccgaggacttcattcgcaaccggggggtac ggttcctcgtgggctgctacatgtcgcacacgcgcaaggcggtgatgccggtggtcgagc gcgccgacgcgctgctctgctacccgaccccctacgagggcttcgagtattcgccgaaca tcgtctacggcggtccggcgccgaaccagaacagtgcgccgctggcggcgtacctgattc gccactacggcgagcgggtggtgttcatcggctcggactacatctatccgcgggaaagca accatgtgatgcgccacctgtatcgccagcacggcggcacggtgctcgaggaaatctaca ttccgctgtatccctccgacgacgacttgcagcgcgccgtcgagcgcatctaccaggcgc gcgccgacgtggtcttctccaccgtggtgggcaccggcaccgccgagctgtatcgcgcca tcgcccgtcgctacggcgacggcaggcggccgccgatcgccagcctgaccaccagcgagg cggaggtggcgaagatggagagtgacgtggcagaggggcaggtggtggtcgcgccttact tctccagcatcgatacgcccgccagccgggccttcgtccaggcctgccatggtttcttcc cggagaacgcgaccatcaccgcctgggccgaggcggcctactggcagaccttgttgctcg gccgcgccgcgcaggccgcaggcaactggcgggtggaagacgtgcagcggcacctgtacg acatcgacatcgacgcgccacaggggccggtccgggtggagcgccagaacaaccacagcc gcctgtcttcgcgcatcgcggaaatcgatgcgcgcggcgtgttccaggtccgctggcagt cgcccgaaccgattcgccccgacccttatgtcgtcgtgcataacctcgacgactggtccg ccagcatgggcgggggaccgctcccatgagcgccaactcgctgctcggcagcctgcgcga gttgcaggtgctggtcctcaacccgccgggggaggtcagcgacgccctggtcttgcagct gatccgcatcggttgttcggtgcgccagtgctggccgccgccggaagccttcgacgtgcc ggtggacgtggtcttcaccagcattttccagaatggccaccacgacgagatcgctgcgct gctcgccgccgggactccgcgcactaccctggtggcgctggtggagtacgaaagccccgc ggtgctctcgcagatcatcgagctggagtgccacggcgtgatcacccagccgctcgatgc ccaccgggtgctgcctgtgctggtatcggcgcggcgcatcagcgaggaaatggcgaagct gaagcagaagaccgagcagctccaggaccgcatcgccggccaggcccggatcaaccaggc caaggtgttgctgatgcagcgccatggctgggacgagcgcgaggcgcaccagcacctgtc gcgggaagcgatgaagcggcgcgagccgatcctgaagatcgctcaggagttgctgggaaa cgagccgtccgcctgagcgatccgggccgaccagaacaataacaagaggggtatcgtcat catgctgggactggttctgctgtacgttggcgcggtgctgtttctcaatgccgtctggtt gctgggcaagatcagcggtcgggaggtggcggtgatcaacttcctggtcggcgtgctgag cgcctgcgtcgcgttctacctgatcttttccgcagcagccgggcagggctcgctgaaggc cggagcgctgaccctgctattcgcttttacctatctgtgggtggccgccaaccagttcct cgag |
>X13776 X13776.1 Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation tgctcgatcaccaccagccgggcgacgggaactgcacgatctacctggcgagcctggagc acgagcgggttcgcttcgtacggcgctgagcgacagtcacaggagaggaaacggatggga tcgcaccaggagcggccgctgatcggcctgctgttctccgaaaccggcgtcaccgccgat atcgagcgctcgcacgcgtatggcgcattgctcgcggtcgagcaactgaaccgcgagggc ggcgtcggcggtcgcccgatcgaaacgctgtcccaggaccccggcggcgacccggaccgc tatcggctgtgcgccgaggacttcattcgcaaccggggggtacggttcctcgtgggctgc tacatgtcgcacacgcgcaaggcggtgatgccggtggtcgagcgcgccgacgcgctgctc tgctacccgaccccctacgagggcttcgagtattcgccgaacatcgtctacggcggtccg gcgccgaaccagaacagtgcgccgctggcggcgtacctgattcgccactacggcgagcgg gtggtgttcatcggctcggactacatctatccgcgggaaagcaaccatgtgatgcgccac ctgtatcgccagcacggcggcacggtgctcgaggaaatctacattccgctgtatccctcc gacgacgacttgcagcgcgccgtcgagcgcatctaccaggcgcgcgccgacgtggtcttc tccaccgtggtgggcaccggcaccgccgagctgtatcgcgccatcgcccgtcgctacggc gacggcaggcggccgccgatcgccagcctgaccaccagcgaggcggaggtggcgaagatg gagagtgacgtggcagaggggcaggtggtggtcgcgccttacttctccagcatcgatacg cccgccagccgggccttcgtccaggcctgccatggtttcttcccggagaacgcgaccatc accgcctgggccgaggcggcctactggcagaccttgttgctcggccgcgccgcgcaggcc gcaggcaactggcgggtggaagacgtgcagcggcacctgtacgacatcgacatcgacgcg ccacaggggccggtccgggtggagcgccagaacaaccacagccgcctgtcttcgcgcatc gcggaaatcgatgcgcgcggcgtgttccaggtccgctggcagtcgcccgaaccgattcgc cccgacccttatgtcgtcgtgcataacctcgacgactggtccgccagcatgggcggggga ccgctcccatgagcgccaactcgctgctcggcagcctgcgcgagttgcaggtgctggtcc tcaacccgccgggggaggtcagcgacgccctggtcttgcagctgatccgcatcggttgtt cggtgcgccagtgctggccgccgccggaagccttcgacgtgccggtggacgtggtcttca ccagcattttccagaatggccaccacgacgagatcgctgcgctgctcgccgccgggactc cgcgcactaccctggtggcgctggtggagtacgaaagccccgcggtgctctcgcagatca tcgagctggagtgccacggcgtgatcacccagccgctcgatgcccaccgggtgctgcctg tgctggtatcggcgcggcgcatcagcgaggaaatggcgaagctgaagcagaagaccgagc agctccaggaccgcatcgccggccaggcccggatcaaccaggccaaggtgttgctgatgc agcgccatggctgggacgagcgcgaggcgcaccagcacctgtcgcgggaagcgatgaagc ggcgcgagccgatcctgaagatcgctcaggagttgctgggaaacgagccgtccgcctgag cgatccgggccgaccagaacaataacaagaggggtatcgtcatcatgctgggactggttc tgctgtacgttggcgcggtgctgtttctcaatgccgtctggttgctgggcaagatcagcg gtcgggaggtggcggtgatcaacttcctggtcggcgtgctgagcgcctgcgtcgcgttct acctgatcttttccgcagcagccgggcagggctcgctgaaggccggagcgctgaccctgc tattcgcttttacctatctgtgggtggccgccaaccagttcctcgag |
>X13776 X13776.1 Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation |
Qualifiers that are in-built for sequence datatypes allow the input and output files to be specified in more detail, for example, the format for the output files.
| Program name | Description |
|---|---|
| aligncopy | Reads and writes alignments |
| aligncopypair | Reads and writes pairs from alignments |
| biosed | Replace or delete sequence sections |
| codcopy | Copy and reformat a codon usage table |
| degapseq | Removes non-alphabetic (e.g. gap) characters from sequences |
| descseq | Alter the name or description of a sequence |
| entret | Retrieves sequence entries from flatfile databases and files |
| extractalign | Extract regions from a sequence alignment |
| extractfeat | Extract features from sequence(s) |
| extractseq | Extract regions from a sequence |
| featcopy | Reads and writes a feature table |
| featreport | Reads and writes a feature table |
| listor | Write a list file of the logical OR of two sets of sequences |
| makenucseq | Create random nucleotide sequences |
| makeprotseq | Create random protein sequences |
| maskambignuc | Masks all ambiguity characters in nucleotide sequences with N |
| maskambigprot | Masks all ambiguity characters in protein sequences with X |
| maskfeat | Write a sequence with masked features |
| maskseq | Write a sequence with masked regions |
| newseq | Create a sequence file from a typed-in sequence |
| nohtml | Remove mark-up (e.g. HTML tags) from an ASCII text file |
| noreturn | Remove carriage return from ASCII files |
| nospace | Remove all whitespace from an ASCII text file |
| notab | Replace tabs with spaces in an ASCII text file |
| notseq | Write to file a subset of an input stream of sequences |
| nthseq | Write to file a single sequence from an input stream of sequences |
| nthseqset | Reads and writes (returns) one set of sequences from many |
| pasteseq | Insert one sequence into another |
| revseq | Reverse and complement a nucleotide sequence |
| seqret | Reads and writes (returns) sequences |
| seqretsetall | Reads and writes (returns) many sets of sequences |
| seqretsplit | Reads sequences and writes them to individual files |
| sizeseq | Sort sequences by size |
| skipredundant | Remove redundant sequences from an input set |
| skipseq | Reads and writes (returns) sequences, skipping first few |
| splitsource | Split sequence(s) into original source sequences |
| splitter | Split sequence(s) into smaller sequences |
| trimest | Remove poly-A tails from nucleotide sequences |
| trimseq | Remove unwanted characters from start and end of sequence(s) |
| trimspace | Remove extra whitespace from an ASCII text file |
| union | Concatenate multiple sequences into a single sequence |
| vectorstrip | Removes vectors from the ends of nucleotide sequence(s) |
| yank | Add a sequence reference (a full USA) to a list file |